13회 생물경시 고등예선 기출문제

13회-고등예선[완성] ←PDF로 보기

 

화면깨짐현상과 그림자료가 보이지 않을수 있으니 PDF로보기를 열으셔서 열람하시기 바랍니다.

 

13회 생물경시 고등예선 기출문제

 

1. 아래 그림은 식물세포와 동물세포의 모식도이다. 잘 관찰한 다음 물음에 답하여라.(기호와 이름을 쓰시오)

 

(1) 식물과 동물의 차이점을 말하여라.

 

(2) 식물세포에 있으나 동물세포에는 없는 세포구조는 무엇인가?

 

(3) 유전인자인 DNA를 가지고 있는 세포구조는 무엇인가?

 

(4) 식물세포에서 ATP가 합성되는 장소는?

 

(5) 동물세포에서 ATP가 합성되는 장소는?

 

(6) 일반적으로 식물세포에서 NADH2와 NADPH2를 만드는 장소는?

 

(7) 일반적으로 동물세포에서 NADH2와 NADPH2를 만드는 장소는?

 

(8) 식물세포의 진화를 세포공생이론으로 설명하여라.

정답 및 해설

 

(1) 동식물간의 가장 큰 차이는 식물은 독립영양생물이지만 동물은 종속영양생물이다.

 

동식물의 차이점으로 영양관계의 차이가 가장 크지만, 그 외에도 식물은 운동성이 없지만, 동물은 운동성이 있다. 식물은 세포벽이 있지만, 동물은 없다. 동물은 식물에 비해 감각기관이 발달되어 있으며, 환경의 자극에 대하여 더 빠르게 반응하고, 물질대사율이 더 높다.

 

(2) 식물세포에만 있는 것으로 세포벽(F), 액포(E), 엽록체(G)를 들 수 있다.

 

액포는 막으로 싸여진 주머니로 내막계에 속하며, 크기와 모양이 다양하고, 여러 가지 기능을 수행한다. 액포에는 생명유지와 활동에 필요한 당, 염류, 유기산, 단백질, 색소 등을 포함하고 있다. 이런 물질들 때문에 삼투압이 생겨 세포 주위로부터 물을 흡수하여 식물의 크기가 커지도록 하며, 팽압이 생긴다.

동물세포에만 있는 것으로 리소솜, 편모, 중심립이 있다. 리소솜은 그리이스어로 분해체라는 뜻이며, 가수분해 효소를 가지고 있다. 음식물을 포함하고 있는 식포와 융합하여 소화를 하며, 또한 박테리아를 분해하고, 손상된 세포내소기관도 분해하여 새로운 소기관을 만드는데 이용한다. 태아 초기 발생 시에 태아의 손가락 사이의 물갈퀴를 제거하는 효소도 포함하고 있다. 편모는 이동에 이용되며, 중심립은 세포분열시 방추사를 제공해 준다.

 

(3) H: 핵, G: 엽록체, C, I: 미토콘드리아.

 

DNA는 세포 안의 핵뿐만이 아니라 동식물 속에 있는 미토콘드리아, 식물세포의 엽록체에서 발견된다. 미토콘드리아는 모계를 통해 다음 세대로 전달된다.

 

(4) G: 엽록체, I: 미토콘드리아, J: 세포질.

 

식물세포에서는 ATP가 엽록체에서 만들어진다. 특히 엽록체의 틸라코이드막에서 광반응 과정을 통해 ATP를 합성하며, 암반응시 이용한다. 또한 ATP가 미토콘드리아에서 만들어지며, 세포질에서 해당과정을 통해 기질특이적 인산화 방법에 의해 일부가 합성된다.

 

(5) C: 미토콘드리아. J: 세포질.

 

동물세포에서 ATP는 주로 미토콘드리아에서 만들어지며, 일부가 세포질에서 기질특이적 인산화 방법에 의해 합성된다.

 

(6) NADH2 : 미토콘드리아(I), 세포질(J).

NADPH2 : 엽록체(G)

 

NADH2는 미토콘드리아와 세포질에서 만들어지며, 식물의 엽록체에서 NADPH2가 명반응 과정에서 만들어져, 이산화탄소를 환원시키는데 이용된다.

 

(7) NADH2 : 미토콘드리아(C), 세포질(J) NADPH2 : 없음

 

NADH2는 해당작용이 일어나는 세포질과, TCA 회로가 돌아가는 미토콘드리아에서 만들어진다. NADH2는 포도당이 분해되면서 NAD+가 환원되어 만들어진다. 세포질에서 해당작용을 통해 포도당이 피루브산이 될 때 NADH2가 만들어지고, 피루브산이 미토콘드리아로 들어가서 이산화탄소로 분해될 때도 NADH2가 만들어진다.

동물에서 pentose phosphate pathway에 의해 NADPH2가 생산된다. 이렇게 생산된 NADPH2는 acetyl-CoA로부터 지방산으로 환원 과정에 이용된다. 따라서 NADPH2는 지방 조직에서 지방산을 합성하는데 이용된다.

하지만, 고등학교 수준에서는 이러한 드문 경우를 물어보는 것이 아니므로 동물에서 NADPH2가 없는 것으로 해도 무방하다.

 

(8) 미토콘드리아나 엽록체 같은 세포소기관은 각각 독립된 생물이었던 것이 한 개의 세포 안에서 공동생활(상리공생)을 하다가 세포기관으로 분화되어 오늘날의 식물세포로 발생했다.

 

미토콘드리아의 조상이 되는 원핵세포(호기성 세균)는 산소를 이용하여 세포호흡을 함으로써 그렇지 않은 혐기성 원핵생물들보다 많은 양의 에너지를 생산하는 작은 독립영양체 이었을 것이다. 이들이 어떤 기회에 더 큰 원핵세포에 기생하였거나, 잡아 먹히게 되어 소화되지 않고 살아남아 공생관계가 성립되었을 것이다. 엽록체의 경우 원시남세균의 상리공생으로 만들어졌을 것이다.

 

 

 

2. 다음 그림은 개구리의 일종인 제노퍼스의 32할구기의 모식도이다. 물음에 답하여라. 발생이 끝난 후 각 할구의 운명은 아래와 같다.

공 여 자 수 용 자 A와 B(식물반구세포)

→창자(내배엽성)

D(중간대)혈액

→(중배엽성)

I(동물반구세포)

→신경조직(외배엽성)

F(동물반구세포)

→표피 (외배엽성)

 

 

 

 

(1) 낭배 초기 C 할구는 무엇으로 되는가?

 

(2) 낭배운동이 끝난 후 C는 무엇으로 되는가?

 

(3) 32할구기와 포배기에 각 세포를 분리한 후 배양한 결과는 다음과 같다.

32할구기 A세포 → 1 표피 세포

32할구기 B세포 → 1 표피 세포

32할구기 C세포 → 1 표피 세포

32할구기 D세포 → 1 표피 세포

32할구기 E세포 → 1 표피 세포

9할구기 F세포 → 1 표피 세포

32할구기 C, D, E, F를 함께 배양

→ 1 표피세포

포배기 A세포 → 창자 세포

포배기 B세포 → 창자 세포

포배기 C세포 → 척 색

포배기 D세포 → 혈 액

위의 실험 결과의 중요성을 설명하여라.

 

 

 

(4) 문제 (3)의 할구 분리 실험을 통하여 알 수 있는 중간대의 운명을 결정하는 부위는 어디인가?

 

(5) D할구를 A할구로 대치시키는 이식 실험 결과의 중요성을 설명하여라.

 

 

정답 및 해설

(1) 원구배순부 또는 원구상순부.

C 지역은 원구배순부 혹은 원구상순부가 되며, 낭배 시 함입이 일어나는 바로 윗 부분이 된다. 낭배 시 함입이 일어날 때의 초기 모습이 마치 입술을 닮았다하여 순부라고 한다. 이 부위는 독일의 발생학자인 슈페만에 의해 형성체(organizer)의 역할을 하는 것으로 발견되었다. 슈페만과 그의 제자인 만골드는 낭배 초기의 원구배순부를 다른 배아의 복측 중간대에 이식시킬 경우 그곳으로부터 새로운 낭배운동이 일어남을 밝혀냈다.

 

(2) 척색(삭).

원구상순부는 낭배가 진행되면서 안으로 함입해 들어가 척삭을 형성하며, 처음 들어간 부분이 앞쪽으로 이동한다. 척삭은 배아를 지지해 주는 역할을 하며, 발생이 진행되면서 일부가 척추를 형성하는데 관여하지만, 대부분은 퇴화한다.

 

(3) 32할구기와 포배기 사이에 C와 D세포가 외배엽성인 표피세포로 될 운명이 각각 척색과 혈구 같은 중배엽성 세포로 운명이 결정(또는 유도)된다. 포배기 전에는 외배엽과 내배엽만이 있지만, 포배 초기에 중배엽이 유도된다.

 

(4) A같은 식물반구세포.

C 지역이 형성체로 2차 배아를 유도할 능력을 가지고 있지만, 이러한 능력을 실제로 그 아래의 내배엽으로부터 온다. C 지역 바로 아래의 외배엽 지역이 C를 중배엽으로 유도하는 능력을 처음으로 뉴쿠프가 발견하였다하여 뉴쿠프센터(Nieuwkoop center)라고 한다. 중배엽은 배아의 중간대 부분에서 형성되며, 중배엽 유도 신호는 그 아래에 위치하는 내배엽으로부터 와서 배측 및 복측 중배엽이 형성된다. 뉴쿠프 센터로부터 오는 신호는 배측 중배엽을 유도한다.

 

(5) 등쪽 식물반구세포(A)가 바로 위에 위치한 중간대의 C세포를 등쪽 중배엽세포로 유도한다. 이들 유도된 세포들이 낭배초기에 원구배순부로 변하여 낭배운동을 일으키며 그 결과 2중배로 발생한다.

3. 근섬유(근육세포)를 며칠동안 0℃의 50% 글리세롤 용액에 넣어두면 세포막이 파괴되고, 근육세포의 수용성 물질은 모두 빠져 나오지만 수축 작용과 관련된 세포골격과 같은 비용해성 물질은 온전하게 남아 있다. 이와 같이 처리한 근육세포를 가지고 여러 가지 조건에서 수축에 따른 장력과 ATP의 가수분해를 측정하여 다음과 같은 결과를 얻다. 이에 근거하여 다음 물음에 답하여라.

 

 

 

 

 

(1) 실험 A의 결과를 보고 내릴 수 있는 결론은 무엇인가?

 

 

(2) 실험 B의 결과를 보고 내릴 수 있는 결론은 무엇인가?

 

 

(3) 실험 C의 결과를 보고 어떤 결론을 내릴 수 있는가?

 

 

 

(4) 실험 D의 결과를 보고 다음에 답하라.

① 칼슘은 있으나 ATP를 제거하였을 때 근육이 이완되지 못하는 현상을 무엇이라고 하는가?

 

 

② 근육세포가 수축하고 이완하는 조건을 설명하라.

 

 

(5) 근육세포에서 칼슘농도는 어떻게 조절되는지 설명하여라

 

 

 

 

정답 및 해설

 

(1) 근수축에는 ATP와 칼슘이 필요하며, 칼슘이 없으면 이완한다.

(2) 근수축의 장력은 칼슘농도에 비례하여 증가하며 포화된다.

(3) ATP분해는 칼슘농도에 비례하여 증가하며 포화된다.

(4) ① 사(후)경직

② ATP 존재하에 칼슘이 있으면 수축하고, 칼슘이 없으면 이완한다.

(5) 운동신경의 흥분이 근육세포에 전달되면 세포막에 활동전위가 발생되며, 이에 따라서 근소포체에 저장되었던 칼슘이 방출되어 칼슘농도가 증가한다. 이 활동전위가 소멸되면 방출되었던 칼슘은 능동수송에 의해 근소포체 내로 운반되기 때문에 농도가 감소한다.

 

[참고] 근육수축의 활주설(sliding-filament theory)

① ATP가 미오신 머리에 결합하면 미오신 머리가 액틴의 결합부위로부터 떨어져 나온다.

② 수축 에너지는 ATP가 ADP와 인산으로 분해되면서 나오며, 이 때 ADP와 인산이 미오신 머리에 붙는다. 미오신은 형태가 바뀌며, 미오신 머리는 다른 액틴분자와 결합할 수 있도록 뒤로 당겨진다.

③ 칼슘이 들어와 액틴의 결합부위를 열어주어 미오신 머리가 액틴에 붙을 수 있도록 해준다.

④ 이 때 ADP와 인산이 떨어져 나가면서 미오신 머리가 휘게 되고, 이 때 발생하는 미오신과 액틴의 움직임이 섬유를 근육원섬유마디의 중심 쪽으로 당기게 된다.

⑤ ATP가 붙으면 다시 ①의 과정으로 돌아간다.

4. 적혈구의 산소운반기능을 담당하는 헤모글로빈 분자는 α-글로빈과 β-글로빈이라는 두 구성성분으로 이루어져 있다. 다음 염기서열은 β-글로빈의 전체 아미노산 서열에 대한 정보를 처음부터 끝까지 간직하고 있는 DNA 이중나선 중한 가닥을 예시하고 있는 것이다. 다른 한 가닥은 이에 정확히 상보적인 서열이다. 현재 분자생물학 실험에서는 PCR(중합효소연쇄반응)이라는 기술로 특정부위 유전자(DNA)를 만들어 낼 수 있다. β-글로빈의 유전자 전부를 PCR하기 위해서 사용되는 2개의 primer (각 15개 염기)를 쓰시오. (단, 염기서열은 5’에서 3’으로 써야하고, β-글로빈을 구성하는 아미노산은 130개 이상이다)

 

5′-ACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGACAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATTGCCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTTTTTGGCCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGGGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTTAACTCGCT-3′

 

 

 

 

 

정답 및 해설

 

4. ① TTAAGTGATACTTGT

② ATGGTGCACCTGACT

 

위의 염기서열은 mRNA로 U를 단지 T로 바꾸어 놓은 것이다. 따라서 이 DNA 염기서열은 mRNA를 만들어내는데 이용되었던 DNA 이중 나선의 가닥 중의 하나와 염기서열이 같다. 염기서열을 예로 들어 설명하면 다음과 같다.

 

DNA 이중나선 5‘-GGAGTCAGGTGCACCATGGTGTCTGT-3′

3′-CCTCAGTCCACGTGGTACCACAGACA-5′

 

DNA 이중나선 중 위의 가닥이 주형으로 작용한다면 만들어지는 mRNA는 다음과 같다.

mRNA 염기서열 3‘-CCUCAGUCCACGUGGUACCACAGACA-5′

하지만, 일반적으로 염기서열은 5‘->3’으로 쓰기 때문에, 180도 뒤집어 놓으면 된다.

mRNA 염기서열 5‘-ACAGACACCAUGGUGCACCUGACUCC-3′

 

요즈음은 편의상 mRNA의 염기서열의 U를 T로 바꾸어 마치 DNA 염기서열처럼 표기한다. 이렇게 바꾸면 mRNA 염기서열은 다음과 같다.

mRNA 염기서열 5‘-ACAGACACCATGGTGCACCTGACTCC-3′

 

이 염기서열은 처음 DNA 이중나선을 보면 mRNA를 만들었던 주형과 상보적인 DNA 즉, 아래 DNA 가닥임을 알 수 있다. 따라서 DNA 가닥의 어떤 것이 주형으로 작용하였다면 그것에 상보적인 가닥이 바로 mRNA의 염기서열이 되는 것이며, 단지 T를 U로 바꾸면 된다.

 

문제의 mRNA 염기서열도 단지 U를 T로 바꾸어 놓은 것에 불과하며, 이것은 원래 이것을 만들었던 DNA 이중 나선 중의 한 가닥이 된다. 본 질문에서는 β-글로빈을 암호화하고 있는 Open reading frame(ORF)만 증폭하고자함을 알 수 있다. ORF는 시작코돈과 종결코돈을 가지고 있는 염기서열이다. ORF는 여러 개 나타날 수 있지만 질문에서 130개 이상의 아미노산을 암호화하고 있는 것을 찾아야 한다. 시작코돈은 AUG이고, 종결코돈은 UAA, UAG, UGA이므로 이들을 포함하는 지역을 찾아 primer를 만드는데 이용한다. 코돈을 DNA 염기서열로 바꾸면 시작코돈은 ATG, 종결코돈은 TAA, TAG, TGA가 된다.

 

 

5′-ACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGACAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATTGCCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTTTTTGGCCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGGGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTTAACTCGCT-3′

 

위에서 음영으로 표시된 부분을 보면 시작코돈으로 ATG와 종결코돈으로 TAA가 있다. 따라서 이 부분을 증폭하고자 하면 5‘쪽에서 primer는 음영으로 표시된 부분의 염기를 그대로 쓰면 된다. 이 염기의 primer 끝에 염기을 붙여나가면 3’쪽으로 위에서 보이는 염기가 만들어진다. 하지만 3‘쪽에서 합성해 오는 경우는 다르다. 즉, 음영으로 표시된 염기에 상보적인 염기를 이용해야 위의 DNA와 상보적인 것이 만들어질 수 있다. 이 상보적인 DNA는 ATGGTGCACCTGACT에 의해 결합되어 DNA를 계속 증폭하는데 쓰인다. 그림을 그려 설명하면 다음과 같다.

 

밑줄 친 3′-TGTTCATACTGAATT-5’을 Primer로 이용하여 위 가닥에 대하여 상보적인 DNA 가닥을 만들면 DNA 이중나선이 된다.

5′-ACAGACACCATGGTGCACCTGACTCC………ACAAGTATCACTTAACTCGCT-3′

3‘-TGTCTGTGGTACCACGTGGACTGAGG <—TGTTCATACTGAATT

 

열을 가하여 두 나선을 풀고 여기에 양쪽에서 primer를 붙여 양 방향에서 DNA를 합성할 수 있다. 새로이 필요한 primer를 아래 가닥을 주형으로 하여 위 가닥을 만드는데 필요함으로 5‘-ATGGTGCACCTGACTCC-3’을 primer로 이용하면 된다.

 

5′-ACAGACACCATGGTGCACCTGACTCC………ACAAGTATCACTTAACTCGCT-3′

<—TGTTCATACTGAATT

 

5‘-ATGGTGCACCTGACTCC—->

3‘-TGTCTGTGGTACCACGTGGACTGAGG………..TGTTCATACTGAATT

 

이 과정을 통해 결국 증폭된 DNA는 다음과 같다. 이 DNA는 ORF만 포함한다.

 

5‘-ATGGTGCACCTGACTCC……..ACAAGTATCACTTAA

3‘-TACCACGTGGACTGAGG………..TGTTCATACTGAATT

 

 

조상환

Leave a Reply

*

captcha *