12회 경시대회 고등본선 기출문제

12회-고등본선[완성] ←PDF로 보기

 

화면깨짐현상과 그림자료가 보이지 않을수 있으니 PDF로보기를 열으셔서 열람하시기 바랍니다.

12회 경시대회 고등본선 기출문제

 

1. 녹색식물은 광합성을 한다. 광합성에는 광(명)반응과 암반응이 있다. 다음 그림은 광합성의 광반응을 상세히 모식적으로 설명하는 그림이다. 자세히 보고 이해한 후 물음에 답하여라.

(1) 광합성에서 광(명)반응이란 무엇인가?

(2) 물의 광분해를 화학식으로 나타내어라.

( )
( ) —————> ( ) + ( )

(3) 다음 열거한 가시광선 중에서 광합성의 광반응에 가장 이용되지 않는 것은?

① 빨간색 ② 주황색 ③ 노란색 ④ 초록색 ⑤ 파란색
⑥ 남색 ⑦ 보라색

(4) PQ pool과 Cyt b6-f 복합체의 역할을 설명하여라.

(5) 광합성에서 ATP의 합성을 화학식으로 설명하여라.

( ) 효소
( ) + ( ) —————> ( )
1.
(1) 녹색식물의 광합성에서 광에너지를 필요로 하는 과정이다. 엽록체의 틸라코이드에서 일어나며, 빛에너지가 흡수되어 광분해로 물을 산화시켜 산소를 발생시키고, 흡수된 빛에너지를 화학에너지(ATP)와 환원압(NADPH + H+)으로 전환시키는 과정이다.

광합성은 크게 광(명)반응과 암반응으로 나눠볼 수 있다. 잎의 기공을 통해서 공기 중의 CO2를 흡수하여 포도당 등의 유기 양분으로 고정시키는 일련의 반응을 암반응, 캘빈 회로라고 하는데 이 과정은 흡열 반응으로서 에너지의 유입이 일어난다. 이 때, 에너지는 ATP의 형태로 공급되는데 이 ATP가 광반응을 통해 엽록체 내부의 틸라코이드에서 생성되는 것이다. 또한 암반응에서 캘빈 회로를 이루는 중간 산물들을 전환시키는데 필수적인 H+를 공급하기 위한 NADPH2도 광반응을 통해서 생성된다.

(2) OEP(Oxygen-evolving protein)
( H2O ) —————–> ( 1/2O2 ) + ( 2H+ )

엽록소 a에서 전자 하나가 방출되면 엽록소 분자는 반응성이 큰 산화 상태가 된다. 유실된 전자는 루멘(lumen)에 다량 존재하는 물에서 온 전자에 의해 보충된다. 망간(Mn)을 함유하고 있는 단백질은 유실된 전자를 인접한 물로부터 얻는다.
조금 더 보충하면,
( 2H2O ) —————–> ( O2 ) + ( 4H+ ) + ( 4e- )
가 되는데 이 때 발생한 전자를 이용하는 것이다. 동시에 발생한 양성자는 루멘으로 방출됨으로써 양성자 기울기의 형성을 돕는다.
(3) 정답: ④
태양 빛의 전자기 파장의 모든 영역 중에서 광합성에 이용되는 것은 가시광선 영역인데 그 중에서도 식물의 잎은 특정 파장의 빛만을 흡수하여 광합성에 이용하는 반면 다른 파장의 빛은 잎에서 반사되거나 투과된다. 엽록체의 틸라코이드 막에는 색소체(pigment) 입자가 있어서 주로 청자색(blue-violet)이나 적황색(red-orange) 파장을 흡수한다. 잎에서 흡수된 파장은 눈으로 볼 수 없고, 대신 색소체가 반사하거나 투과시킨 녹색 파장의 빛에 의해 잎이 녹색으로 보인다.

(4) PQ pool과 Cyt.b6-f 복합체는 H+pumping 작용을 하여 H+를 스트로마에서 루멘으로 수송하는 역할을 한다. 엽록소 a의 반응 중심(center of reaction)에서 태양빛에너지에 의해 여기된 전자는 작고 운동성을 가지는 운반자인 플라스토퀴논(plastoquinone)으로 즉시 전달된다. PQ는 양성자를 펌프할 때 중요한 역할을 하는데, 스트로마의 양성자를 포획하여 루멘으로 방출하여 화학 삼투적 기울기를 형성한다. 이 일이 끝나면 PQ는 전자를 그 다음 전자 운반자인 Cyt. complex에 전달한다.

(5) (ATP합성)효소
( ADP ) + ( Pi ) ( ATP )
2. 다음은 포도당이 피루브산으로 분해되고, 피루브산이 완전히 분해되는 과정을 모식적으로 나타낸 것이다. 그림을 참고로 하여 물음에 답하여라.

(1) 1몰의 포도당이 피루브산으로 분해되는 과정은 어디에서 일어나며 몇 몰의 NADH와 ATP를 생성하는가?

① ( ) ② ( )NADH
③ ( )ATP

(2) TCA 회로는 어디에서 일어나며, 2회의 TCA회로 동안 생성되는 NADH, ATP 및 FADH2는 각각 몇 몰씩인가?

① ( ) ② ( )NADH
③ ( )ATP ④ ( )FADH2

(3) 피루브산이 활성아세트산으로 되는 과정을 화학식으로 나타내어라.

(4) 포도당 1몰이 산소호흡으로 완전히 분해되어 생긴 ATP는 36몰이다. 그러나 ATP로 전환되기 전의 NADH와 FADH2의 에너지를 따지면 38몰로 계산된다. 이 까닭을 설명하여라.

(5) 호흡기질로 포도당 1몰이 쓰였을 때 세포의 산소호흡과정에서 발생되는 화학에너지는 36몰 ATP이다. 포도당 1몰을 열량계로 연소시키면 686Kcal의 열에너지가 발생된다 산소호흡의 에너지 효율을 계산하여라. 단, ATP 1몰이 가지고 있는 에너지는 7.3Kcal이다.
2.
(1) ① 세포질 ② 2 ③ 2
해당과정(glycolysis)은 세포질에서 일어나며 포도당을 불안정화 시키기 위해 2ATP를 소모하고 차후 4ATP를 형성하여 순수하게 2ATP를 생성한다.

(2) ① 미토콘드리아 내부기질 ② 8 ③ 2 ④ 2
해당과정 결과 생성된 피루브산이 미토콘드리아의 기질(matrix)로 들어와 TCA회로를 거치게 된다. ‘2회의 TCA 회로 동안’이라고 한 것은 포도당 1분자 당 2분자의 피루브산이 생성되었기 때문이다.

(3)

NAD는 탈수소 효소의 조효소이다. 따라서 주효소의 명칭은 단순히 피루브산 탈수소효소라고 해도 무방하다. 피루브산은 C3(C3H4O3)인데 CO2 1분자가 빠져나감에 따라 활성아세트산은 C2가 된다.

(4) 포도당 1몰이 산화될 때 해당과정에서 생성된 세포질의 NADH 2몰이 산화되기 위해서 미토콘드리아로 들어 가야하기 때문이다. 세포질에 있는 NADH가 미토콘드리아로 들어갈 때 전자를 FAD로 전달하여 FADH2를 형성하기 때문에 결국 2개의 ATP만 생성된다. 그러므로 해당과정에서 형성된 2몰의 NADH에 대한 ATP가 2몰이 줄어들게 되어 36몰이된다.
NADH의 형태로 전자전달계에 투입된 것은 1분자당 3ATP를, FADH2의 형태로 투입된 것은 1분자 당 2ATP를 생성한다. 이로써 구해본 전체 ATP의 양은
(2+2)ATP + {(2+8)NADH×3ATP} + (2FADH2×2ATP) = 38ATP
이나 세포질에서의 해당과정 결과 생성된 NADH가 미토콘드리아로 들어갈 때 그것을 운반하는 shuttle protein이 2ATP를 소모하기 때문에 36ATP가 되는 것이다.

(5) 7.3Kcal/mol×36mol/686Kcal×100 = 38.3%

3. 다음 사진은 성게의 난자에 도달한 정자의 사진이다. 물음에 답하여라.

(1) 난자의 표면에 도달한 후 정자의 머리에서 일어나는 현상은 무엇인가?

(2) (1)의 과정과 결과를 설명하여라.

(3) 정자가 난자의 표면에 고르게 분포하고 있지 않은 이유는?

(4) 여러 개의 정자가 난자 속으로 들어가는 다정자 수정이 일어나면 어떻게 되는가?

(5) 다정자 수정을 방지하는 메카니즘을 설명하여라.

 
3.
(1) 첨체반응
첨체는 정자의 머리부분에 있는 세포소기관이다. 수정에 앞서 정자가 난자 표면에 접할 때, 난자 유래의 특정물질(성게에서는 젤리층의 산성당단백질)의 작용에 의해서 첨체는 급속히 변화한다. 이 변화를 첨체반응(acrosome reaction)이라고 부른다. 첨체는 파열하여 그 속에 있는 효소가 분비되어 난자의 막을 용해시킨다.

(2) 침체막이 표면의 세포막과 융합하게 속의 내용 물질을 밖으로 내보낸다. 침체돌기가 형성되고 그 주위에 첨체 속에 들어있던 내용물이 부착된다. 분비된 효소들이 난의 주위막을 융해시킨다. 바인딘이 난황막의 수용체와 결합한다.

정자가 젤리막(jelly coat)에 침입하면 효소가 들어 있는 첨체에서 첨체반응(acrosomal reaction)이 일어난다. 우선 첨체가 파열하여 효소를 방출함으로써 젤리막과 난황층(vitelline layer)을 통과하는 길을 소화한다. 그 후 길다란 첨체돌기(acrosomal process)가 돌출하며, 수정에 성공하는 정자의 첨체돌기는 난의 표면에 붙는다. 그 후 난의 표면이 정자를 향해 융기되어 수정돌기(fertilization cone)를 형성하며, 미세융모(microvillus)가 정자 두부를 싸서 정자를 난 속으로 잡아당긴다. 정자 두부는 핵을 방출하여 정자와 난자의 핵, 즉 전핵(pronucleus) 사이에 미세소관이 형성되어 두 핵들을 서로 잡아당김으로써 수정이 완결된다.

(3) 바인딘의 수용체가 난황막에 고르게 분포되어 있지 않기 때문

(4) 유전자의 조합이 달라지고 또 다른 중심립이 들어와 잉여의 방추사의 형성 부위가 만들어져 염색체의 분리에 혼란이 일어나 발생이 즉각적으로 중단된다.
난자 1개에 정자가 2개 침입했을 때 쌍생아가 된다고 잘못 이해하고 있는 경우가 많은데 보통 두 개 이상의 정자의 난의 세포질 속으로 들어가면 다정자수정(polyspermy)이라 부르고, 이런 경우에는 배가 죽게 된다.

(5) 급속 방지(일시적 방지) : 정자 부착점에서부터 난자막의 막전위 변화가(-7OmV에서 +10mV로) 일어나 난자 표면에 빠른 속도로 전파되어 그 결과 막의 성분에 변화를 일으켜 수정을 방지한다. 그러나 1분 정도 지나면 원상태로 되돌아간다.
완만 방지(영구적 방지) : 피층반응의 결과로 수정막을 형성하는 영구적인 방지책이다. 정자가 난자에 도달하면 Ca2+농도가 올라가게 되고 그 결과, 난자막 바로 밑에 위치하고 있던 피층 과립들이 난자막과 융합하여 내용물을 세포막과 난황막 사이로 분비한다. 내용물 중 어떤 효소는 난황막을 단단하게 만들며 또 다른 효소는 바인딘 수용체를 제거하여 정자가 더 이상 부착하지 못하도록 만든다. 피층 반응 결과 단단하고 두텁게 변한 난황막이 수정막이다.
정자가 난자의 원형질막에 붙으면 신경충격과 같은 갑작스런 전기적 변화가 일어나는데 이로 인해 더 이상의 정자가 유입되지 못한다. 그런데 이것은 매우 일시적이어서 약 20초 정도 지속되었다가 회복된다.
영구적 방지법인 수정막(fertilization membrane)의 형성은 피층반응(cortical reaction)으로 시작된다. 피층립(cortical granules)들이 원형질막에 모여 융합되면서 효소를 방출하고 효소의 작용에 의해 난황층은 위쪽으로 융기되어 정자의 침입을 막는 막으로 변하는 것이다.

A
B
6일
8일
10일
12일
4. 다음 그림은 올챙이의 꼬리를 잘라 배양한 것이다. 물음에 답하여라. A그림은 배양액에 (가)물질을 첨가하지 않은 대조군이고, B는 (가)물질을 첨가하여 배양한 실험군이다.
(1) A와 B의 배양결과 나타난 차이점은 무엇인가?

(2) (가)는 어떤 물질인가?

(3) 올챙이의 변태과정에서 (가)물질은 어디에서 분비되는가?

(4) 만약 올챙이로부터 (가)를 분비하는 기관을 제거하면 어떻게 되는가?

(5) 어린 올챙이에 (가)를 포함하고 있는 먹이를 계속 주면 어떻게 되는가?

(6) 올챙이의 변태과정에서 꼬리의 퇴화 외에 또 다른 변화의 예를 들어라.

(7) 꼬리가 퇴화하는 변태과정동안 리소좀의 양과 그 속의 단백질에 어떤 변화가 일어나는가?
4.
(1) B에서는 꼬리의 퇴화가 일어난다.
올챙이의 꼬리가 짧아지는 것은 리소솜에 저장된 가수분해 효소에 의해 이루어진다. 즉, 리소좀이 터지면서 세포를 분해하여 흡수함으로써 꼬리가 점점 짧아지는 것이다.

(2) 티록신
티록신은 갑상선에서 분비되는 호르몬으로 요오드(I)를 함유하고 있다. 사람에서는 물질대사를 활발하게 하여 체온상승, 심장 박동 증가, 지방 분해의 증가 등을 일으킨다. 개구리의 경우 올챙이에서 개구리로의 변태를 촉진한다.

(3) 갑상선
갑상선은 사람의 경우 목부분의 기관에 붙어 있는 내분비선이다.

(4) 변태가 일어나지 않고 올챙이 상태로 크게 자란다.

(5) 어린 올챙이가 일찍 변태를 일으켜 작은 개구리로 된다.

(6)
가. 호흡기-아가미가 퇴화하고 폐가 발달한다. 피부 호흡한다.
나. 순환기-1심방 1심실이 2심방 1심실로 변한다.
다. 영양-초식성에서 육식성으로 변한다 창자가 짧아진다.
라. 눈-옆에 붙어있던 눈이 중앙으로 몰리면서 깜박막이 생긴다.
마. 배설-암모니아로 배설되던 것이 요소의 형태로 배설된다.
바. 운동기간-꼬리가 없어지고 앞뒷다리가 생긴다.

(7) 리소좀의 양이 증가된다. 리소좀내의 단백질 분해효소를 비롯한 여러 종류의 가수분해효소의 농도가 증가하여 조직을 빠른 속도로 파괴시킨다.

5. 칼슘이 없는 생리식염수에 다음의 그림과 같이 운동신경이 시냅스를 이루고 있는 근육을 담가놓고 운동신경에 동일한 크기의 자극을 주었을 때 나타나는 근육의 막전위(Vm)의 크기와 축색 말단에 흘려준 염화칼슘의 효과를 분석한 결과이다 (A-D). (그림 A-D 에서 ━ 는 칼슘을 흘려준 시간을, 세로줄은 자극을 준 시간이다.)

(1) 그림 A와 B를 비교하여 축색 말단에 흘려준 염화칼슘의 효과를 설명하여라.
(2) 그림 C를 보고 내릴 수 있는 결론은 무엇인가?
(3) 그림 D를 보고 어떤 결론을 내릴 수 있는가?
(4) 이 그림과 관련하여 근육의 강직경련을 설명하여라.

 

5. ① ② ③ 번은 답의 정확도입니다.

(1) ① 근육의 탈분극을 강화시킨다 (더욱 큰 반응이 일어난다).
② 운동신경 자극시에 관여하여 막전위에 영향을 미친다.
③ 탈분극을 도와서 활동전위 형성을 돕는다.

[참고] 근섬유의 흥분
신경 말단에 전달된 자극은 아세틸콜린을 분비함으로써 활동전위를 유발한다. 이는 매초 약 10m의 속도로 순식간에 근섬유의 끝까지 전파되는데, 동시에 각 Z막부에서는 구심상으로 근섬유 내부에도 파급하며, 근소포체에 영향을 주어서 여기에 포함되어 있던 Ca2+을 방출시킨다. Ca2+이 유리되면 ATP와 미량의 Mg의 존재하에서 미오신의 ATP 분해효소 작용이 높아지고, ATP가 분해되어 에너지가 유리된다. 이 에너지에 의하여 액틴과 미오신의 상호반응, 즉 수축이 시작된다. 수축이라고 하지만 필라멘트가 줄어드는 것은 아니며, 액틴 필라멘트가 미오신 필라멘트 사이로 미끄러져 들어가 근수축이 일어나는데, 이것을 활주설(滑走說)이라고 한다(H.E.헉슬리 설).
(2)
① CaCl2는 자극 순간에 역할을 한다. 또는 자극 뒤에 준 칼슘은 효과가 없다.
② Ca2+는 전달물질이 분비될 때 필요하다.
③ Ca2+를 흘려주어야 근육 운동에 영향을 미친다.

(3) ① CaC12 존재 하에 운동신경 전달이 반복될수록 근육의 탈분극이 증폭 (강화)된다. (변화량이 더 커진다)
② 일정하게 칼슘을 주면서 자극을 주면 막전위가 어느 정도까지 증가한다.
③ 첫 번째 자극에서 주어진 칼슘이 두 번째 준 칼슘과 같이 영향을 미친다.

(4) ① CaC12 존재 하에 높은 빈도로 운동신경의 자극이 오면 근육은 강수축이 강화되어 강직경련이 될 수 있다.
② Ca2+공급과 자극이 계속되면 근육 막전위가 커져서 근육 경련에 이를 수 있다.
③ 일정하게 자극을 주면 막전위가 계속 커져 강직경련에 이른다.
④ 신경전달 물질이 덜 제거된 상태에서 계속 자각이 오면 근육은 계속 수축된다.
6. 다음 그림은 20종의 아미노산의 화학적 구조를 나타낸 것이다. 그림을 보고 다음 물음에 답하라.

(1) 위 20개의 아미노산으로 폴리펩티드를 만들려고 한다. 이 폴리펩티드의 아미노(N)-말단에는 측쇄(R기)가 양전하를 띠는 아미노산을 놓고, 카르복실(C)-말단에는 그 측쇄가 음전하를 띠는 아미노산을 배치할 경우 각 말단에 올 수 있는 아미노산의 명칭을 모두 쓰라.
N-말단 :
C-말단 :

(2) 위의 폴리펩티드에서 휨을 제거하려면 어떤 아미노산을 제거해야 하겠는가? 그리고 그 이유는 무엇인가?

(3) 위의 아미노산들이 폴리펩티드를 형성하였을 경우 이황화 결합(disulfide bond)을 만들 수 있는 아미노산은 어느 것인가?

(4) 이들 아미노산 15개를 중합한 폴리펩티드가 하나의 알파나선 구조로 세포막 속에 박혀있을 수 있도록 폴리펩티드를 설계하여라. (단, 아미노산은 중복하여 사용할 수 있으며, 다양한 종류를 사용해야 한다).

6.
(1) N-말단 : 리신, 아르기닌, 히스티딘
C-말단 : 아스파르트산, 글루탐산

측쇄(R기) 부분에 ‘+’ 표시가 있는 것들을 찾으면 된다. 실제로 아미노산의 구조식이 제시되지 않았다 하더라도 염기성 R기를 가진 아미노산과 산성 R기를 가진 아미노산을 구분하여 암기해둘 필요는 있다.
․비극성 R기를 가진 아미노산 : 알라닌, 이소류신, 류신, 메티오닌, 페닐알라닌, 프롤린, 트립토판, 발린
․비전하 극성 R기를 가진 아미노산 : 아스파라긴, 시스테인, 글루타민, 글리신, 세린, 트레오닌, 티로신
․산성 R기를 가진 아미노산 : 아스파르트산, 글루탐산
․염기성 R기 가진 아미노산 : 아르기닌, 히스트딘, 리신

(2) 프롤린
why: α-아미노시가 측쇄와 고리를 형성하여 펩티드 결합 각도를 변화시켜 휨(2점)
프롤린(Pro)은 독특하게도 R기와 아미노기가 결합되어 있기 때문에 정상적인 아미노기-카르복시기의 결합 양상에 지장을 줄 수 있다.

(3) 시스테인
극성 아미노산의 하나이지만 비전하성 아미노산인 시스테인(Cys)은 독특한 성질을 갖는다. 이 아미노산은 설프히드릴기(sulfhydryl group -SH)를 갖는데, 어떤 조건 하에서는 이웃하는 시스테인 -SH간에 공유결합이 생겨 디설피드결합(disulfide linkage)를 이루기도 한다. 물론 메티오닌(Met)도 S를 가지지만 측쇄 끝 부분에 노출되어 있지 않기 때문에 직접 반응에 참여하는 것은 어렵다.

(4) 측쇄가 소수성인 아미노산 15개를 나열해야 하거나 양끝에만 전하를 띤 아미노산을 포함한 경우를 써야한다.

세포막 속에 박혀 있다는 것은 아미노산의 중합체가 전적으로 소수성임을 말해주므로 비극성 R기를 가진 아미노산인 Ala-Ile-Leu-Met-Phe-Pro-Trp-Val-Asn-Cys -Gln-Gly-Ser-Thr-Tyr 등의 설계를 하면 된다. 다만 중합체 중간에 프롤린이 포함될 경우 정상적인 결합이 일어나지 않음을 고려한다.

7. Khorana라는 과학자는 유전자 암호(genetic code)를 밝혀내기 위한 방법으로, 반복적인 염기서열을 가진 다양한 mRNA를 인위적으로 합성하여 대장균을 분쇄한 용액 속에 Translation(번역)이 일어나게 하여 폴리펩티드를 합성했다.-예를 들어, (CAC)n의 경우, 이것은 다시 CACCACCACCACCAC… 란 폴리펩티드가 합성된다.-합성된 폴리펩티드는 단지 한 종류의 아미노산(a homopolymer)만을 가질 수도 있고, 때로는 사용된 반복 서열에 따라 한 종류 이상의 아미노산(a heteropolymer)을 가질 수도 있다. 더군다나, 같은 mRNA로부터 다른 종류의 폴리펩티드가 만들어지기도 한다. 이것은 단백질 합성의 시작이 항상 mRNA의 가장 끝 쪽 뉴클레오티드 에서만 시작되는 것이 아니라는 사실을 말해주는 것이다. 예를 들어, (CAC)n으로부터 3개의 폴리펩티드가 만들어졌다고 하면, 이들은 아마도 염기서열의 다른 지점에서부터 출발하여 다음과 같이 읽혀지게 된 것이라 할 수 있다.

CAC CAC CACCAC…, ACC ACC ACC ACC…, CCA CCA CCA CCA…

다음 표는 Khorana의 실험에 의해 얻어진 결과들이다.

합성한 mRNA
합성 된 polypeptide(s)
(UC)n
(UG)n
(AC)n
(AG)n
(UUC)n
(UUG)n
(AAG)n
(CAA)n
(UAC)n
(AUC)n
(GUA)n
(GAU)n
(UAUC)n
(UUAC)n
(GAUA)n
(GUAA)n
( Ser-Leu)n
(Val-Cys)n
(Thr-His)n
(Arg-Glu)n
(Ser-Ser)n 과 (Leu-Leu)n 과 (Phe-Phe)n
(Leu-Leu)n 과 (Val-Val)n 과 (Cys-Cys)n
(Arg-Arg)n 과 (Lys-Lys)n 과 (Glu-Glu)n
(Thr-Thr)n 과 (Asn-Asn)n 과 (Gln-Gln)n
(Thr-Thr)n 과 (Leu-Leu)n 과 (Tyr-Tyr)n
(lie-lle)n 과 (Ser-Ser)n 과 (His-His)n
(Ser-Ser)n 과 (Val-Val)n
(Asp-Asp)n 과 (Met-Met)n
(Tyr-Leu-Ser-lle)n
(Leu-Leu-Thr-Tyr)n
없음
없음
※ 위에 나열된 폴리펩티드 또는 아미노산의 순서는 mRNA의 염기 순서와 관계없음. 단, (UAUC)n 과 (UUAC)n는 순서대로 적용할 것.

(1) 표-1에서 (GUA)n 과 (GAU)n는 왜 단지 2개의 homopolypeptides만 coding하고, (GAUA)n 과 (GUAA)n 는 폴리펩티드를 합성할 수 없었는가?

(2) 아래 제시된 각각의 트리플렛에 대한 아미노산을 지정하라.
( ⇒ 여러 개의 코돈이 한 종류의 아미노산을 결정할 수 있으며, 보통 첫 번째와 두 번째 염기는 중요하지만, 세 번째 염기는 항상 중요하게 작용하는 것은 아니다. 또 한, 매우 다르게 보이는 코돈이 때로는 같은 아미노산을 결정하기도 한다.)
AAC
CAA
GAA
UAC
AAG
CAC
GAG
UAG

CAU
GAU
UAU

 
ACA
CUA
GUA
UCA
ACU
CUC
GUG
UCU

CUU
GUU

 

 

AGA
UGA
AGU
UGU

 
AUC
UUA
AUG
UUC

 

UUG

 

7. (1)
(GUA)n –> GUAGUAGUA.. –> GUA Ser
AGU Val / UAG stop
(GAU)n –> GAUGAUGAU.. –> GAU Asp
AUG Met / UGA stop
(GUA)n의 경우 UAG가 (GAU)n의 경우 UGA가 stop codon이므로 두 종류의 homopolypeptides만 coding하게 된다.
(GAUA)n –> GAU AGA UAG AUA
AUA GAU AGA UAG
UAG AUA GAU AGA
(GUAA)n –> GUA AGU AAG UAA
UAA GUA AGU AAG
AAG UAA GUA AGU
(GAUA)n 의 경우 형성되는 UAG가, (GUAA)n의 경우 UAA가 stop codon 이므로 모든 경우에 있어서 폴리펩티드가 형성될 수 없다.
문제가 길고 복잡하지만 풀이 방법을 일부 제시하고 있으므로 정확하게 판단만 한다면 간단하게 답을 찾을 수 있다.

(2)
[풀이과정]
1) 주어진 표-1에서 각각의 repeat sequence에 대해 a.a를 matching시키기 위해 나열해 보면,
ⅰ) dinucleotide repeat sequence에서 한 예를 들면,
(UC)n ⇒ UCUCUCUC… ⇒ UCU, CUC의 두 가지 경우가 나온다.
각각에 대해 두 가지 a.a이 주어지므로 UCU/CUC⇒Ser/Leu 또는 Leu/Ser이 될 수 있다.
ii ) trinucleotide repeat sequence 경우,
(UUC)n ⇒ UUCUUCUUC… ⇒ UUC, UCU, CUU의 세 가지 경우가 나오므로
각각의 homopolypeptide sequence가 세 가지 주어졌으므로 각각에 대해
UUC Ser
UCU ⇒ Leu 중의 하나와 대응되게 된다.
CUU Phe
ⅲ) tetranucleotide repeat sequence 경우,
(UAUC)n ⇒ UAUCUAUCUAUCUAUC‥‥
이 경우는 네 가지 codon이 순서적으로 반복되므로 각각 나을 수 있는 서열은
① (-UAU-CUA-UCU-AUC-)n
② (-AUC-UAU-CUA-UCU-)n 의 세 가지 경우가 나오는데, 표 1에서
③ (-UCU-AUC-UAU-CUA-)n 순서적으로 a.a을 나열해 놨으므로
-Tyr – Leu- Ser – Ile –

2) 이와 같이해서 구한 data로부터 표-1에서 주어진 a.a 별로 가능한 triplet codon올 모두 나열하여 하나씩 matching시켜 본다. 이때, 표-1에서 자주 등장하지 않는 a.a부터 먼저 따져서 하나씩 지우면서 가능성을 높여나간다.

3) 마지막으로 앞의 1.에서 나열해놓은 codon과 a.a를 일대일로 matching시켜 본다.
참고로 Gln, Asn, Met, Asp의 경우에는 data가 한 경우밖에 없어서 정확하게 따질 수 없다.

표-1을 정리해 보면
① dinucleotide repeat sequence
(UC)n –> UCUCUCUCUC.. –> UCU Ser
CUC Leu
(UG)n –> UGUGUGUGUG.. –> UGU Val
GUG CyS
(AC)n – -> ACACACACAC.. –> ACA Thr
CAC His
(AG)n –> AGAGAGAGAG. –> AGA Arg
GAG Glu
② trinucleotide repeat sequence
(UUC)n –> UUCUUCUUC.. –> UUC Ser
UCU Leu
CUU Phe
(UUG)n –> UUGUUGUUG.. –> UUG Leu
UGU Val
GUU Cys
(AAG)n –> AAGAAGAAG.. –> AAG Arg
AGA Lys
GAA Glu
(CAA)n –> CAACAACAA.. –> CAA Thr
AAC Asn
ACA Gln
(UAC)n –> UACUACUAC.. –> UAC Thr
ACU Leu
CUA Tyr
(AUC)n –> AUCAUCAUC.. –> AUC Ile
UCA Ser
CAU His
(GUA)n –> GUAGUAGUA.. –> GUA Ser
AGU Val
(GAU)n –> GAUGAUGAU.. –> GAU Asp / UAG stop
AUG Met / UGA stop
UGA

③ tetranucleotide sequence
(UAUC)n –> UAUCUAUCUAUCUAUCUAUC…
ⅰ) -UAU-CUA-UCU-AUC- UAU CUA
ⅱ) -AUC-UAU-CUA-UCU- AUC – Tyr UAU – Leu,…
ⅲ) -UCU-AUC-UAU-CUA- UCU AUC
-Tyr- Leu -Ser- lle –

(UUAC)n –> UUACUUACUUACUUACUUAC
ⅰ) -UUA-CUU-ACU-UAC- UUA UAC
ⅱ) -UAC-UUA-CUU-ACU- UAC – Leu, ACU – Tyr,…
ⅲ) -ACU-UAC-UUA-CUU- ACU CUU
-Leu- Leu -Thr- Tyr –
[정 답]
위의 풀이과정에서 나온 결과를 a.a에 대해 정리해 보면
① Ser — UCU / UCA / AGU…
② Leu — CUU / UUG / CUA / CUC / UUA
③ Phe — UUC
④ Val — GUU / GUA / GUG
⑤ Cys — UGU
⑥ Arg — AGA ( 두 경우 중 하나 )
Glu — GAA / GAG
⑦ Lys — AAG
⑧ Thr — ACA / ACU
⑨ Asn — CAA ( 두 경우 중 하나 )
Gln ACA
⑩ Tyr — UAC / UAU
⑪ Ile — AUC
⑫ His — CAU / CAC
⑬ Asp — GAU ( 두 경우 중 하나 )
Met AUG
⑭ stop — UAG / UGA

8. 과학이 발달되면서 과학자들은 생명체를 이루는 구성성분 중에서 제일 중요한 단백질의 구조를 알기 위하여 많은 노력을 하였다. 지금은 단백질을 이루는 아미노산의 서열을 알 수 있는 방법이 자동화되었지만, 그 당시에는 복잡한 방법을 사용했다. 단백질의 아미노산 서열을 알기 위하여, 먼저 단백질을 이루고 있는 전체 아미노산 종류와 수를 알아냈다. 다음에 단백질을 완전한 가수분해가 아닌 일부 가수분해를 시켜서 다시 작게 만들어진 펩티드를 분리하고, 분리된 각 펩티드를 이루는 각각의 아미노산 종류를 찾아내어 처음 단백질의 아미노산 서열을 밝혀냈다.
다음과 같은 실험결과로부터 처음 단백질의 아미노산 서열 전체를 밝혀내시오.

▶ Sanger reagent를 써서 단백질이 N-쪽 끝 아미노산이 Glu이라는 것을 알았다.
▶ 이 단백질을 이루는 아미노산의 종류와 수는 다음과 같다.
▶ 일부 가수분해 후 작게된 펜티드의 구성은 다음과 같다.
a 펩티드 (Asn, Glu)
b 펩티드 (Glu, Gly)
c 펩티드 (Asn, Glu, Gly)
d 펩티드 (Asn, Val)
e 펩티드 (Asn, Ser, Val)
f 펩티드 (Asn, Glu, Lys)
g 펩티드 (Leu, Ser)
h 펩티드 (Asn, Lys)
i 펩티드 (Arg, Leu)
j 펩티드 (Arg, Arg, Leu)
k 펩티드 (Arg, Lys)
1 펩티드 (Asn, Gly, Val)

 

 

8. Glu – Gly – Asn – Val – Ser – Leu – Arg – Arg – Lys – Asn – Glu

a 펩티드라는 것이 (Asn, Glu)라고 적혀있지만 실제로는 (Glu, Asn)일 수도 있기 때문이다. 즉, 각 펩티드에서 맞물리는 부분을 찾아서 연결을 시도해보면 답을 찾을 수 있는데 일단 N-말단의 아미노산이 Glu임을 제시해주었으므로 Glu가 노출된 펩티드를 중심으로 찾기 시작하는 것이 바람직하다.

아미노산
CO2
H2O
H2O
H2O
H2O
아르기닌
(가)
분해
(나)
에너지
에너지
세포내호흡
9. 다음 그림은 인체에서 일어나는 해독 과정의 일부를 나타낸 것이다.

 

(1) 이 해독 과정이 일어나는 기관은?

(2) 아미노산의 분해 과정에서 생기고 인체에 해로운 물질은?

(3) 그림에서 (가)에 해당하는 물질은 무엇인가?

(4) 그림에서 (나)에 해당하는 물질은 무엇인가?

 

9. (1) 간

(2) 암모니아 (NH3)

(3) 요소 (CO(NH2)2)

(4) 오르니틴

배설은 아미노산에 함유된 질소의 질소성 노폐물을 효과적으로 내보내기 위한 과정인데 NH3을 직접 배설하려면 물이 다량 소모되므로 독성이 덜한 요소로 전환하여 일시 저장하였다가 배출하게 된다. 이 과정은 간이 담당하고 있으며 오르니틴 회로라고 한다. 이 회로는 어느 단계에서 NH3가 투입되고 또 요소가 나오는지 주목해서 볼 필요가 있다.
10. 어떤 생물학자가 다음과 같은 동물을 발견하여 분류하고자 한다.
몸은 검은 갈색이면서 길이는 30cm정도이다. 피부가 점액으로 덮여있고 매끄럽다. 수중 생활을 하고, 납작한 꼬리가 있다. 납작하고 짧은 머리에는 붉은 색의 외부 아가미가 있다. 4개의 약한 다리를 갖고 있다. 발가락은 있으나, 발톱은 없다. 등 쪽에는 신경색이 있고, 두개골과 척추를 갖고 있다. 이 동물은 물고기 알, 가재, 또는 다른 수중 동물을 먹고산다.

(1) 이 동물 속하는 문에 대한 단서는 무엇인가?

(2) 이 동물은 다음 중 어느 무리일 가능성이 가장 큰가?

① 어류 ② 조류 ③ 파충류 ④ 양서류 ⑤ 포유류

(3) 이 동물을 분류하는 데 있어서 가장 도움이 안 되는 정보는?

① 척추를 가지고 있다. ② 등쪽에 신경색이 있다.
③ 몸의 길이가 30cm이다. ④ 4개의 약한 다리를 가지고 있다.
⑤ 피부가 점액으로 덮여있고 매끄럽다.

(4) 이 동물의 특징으로 보아 배엽은 어느 단계까지 분화하였겠는가?

 

10.
(1) 척추를 갖고 있다.
동물계 아래에는 다양한 문이 있는데 그 중에서 척삭동물문임을 알 수 있다.

(2) 정답: ③
<척추동물 각 강의 비교>

분류
체표
다리
호흡기
심장
신장
체온
수정
출산
종류




원구류
피부
없다
아가미구멍
1심방
1심실
전신
변온
체외
난생
칠성장어
먹장어
어 류
비늘
가슴,
배지느러미
아가미
1심방
1심실
중신
변온
체외
난생
상어
붕어
양서류
피부
있다
폐,
피부
2심방
1심실
중신
변온
체외
난생
도롱뇽
개구리


막류
파충류
비늘
있다

2심방
불완전2심실
후신
변온
체내
난생
도마뱀
악어
조 류
깃털
있다

2심방
2심실
후신
정온
체내
난생
닭, 펭귄
포유류

있다

2심방
2심실
후신
정온
체내
난생
쥐, 사람
(3) 정답: ③
동물 분류에 있어서 개체의 크기는 기준이 될 수 없다.

(4) 3배엽 단계까지 분화했을 것이다. (중배엽까지 분화했을 것이다, 3배엽성일 것이다)
신경색이 있음을 통해 알 수 있다.

제 12 회 전국 중․고등학생 수학․과학 경시대회
고등생물부문 본선 2차(실험) 문제

1.
(1) 마이크로미터를 사용하여 다음 프레파라아트에 있는 포자의 가로, 세로의 길이를 구해보시오. 반드시 단위를 쓰시오.
단, 400배로 관찰했을 때 대물마이크로미터 (굵은선)와 접안마이크로미터 (가는 선)의 눈금은 왼쪽그림과 같고, 대물마이크로미터 한 눈금 길에는 10㎛이다.

가로: ( ) 세로: ( )

(2) 무궁화의 화식도를 그리시오.

(3) 다음 두 군집의 유사도를 계산하시오.(단, 각 기호는 종을 의미한다.)
유사도지수 = 2c/(a+b) (a는 A군집의 종수, b는 B군집의 종수, C는 공통인 종수)

(4) 다음 시험대에 있는 시약을 사용하여 녹말이 들어 있는 시험관을 찾아보시오.

2. 현미경 아래에 있는 것은 초기 발생 단계의 개구리 배 (Xenopus embryo)이다. 그 중 낭배를 골라라.

낭배라고 주장하는 근거는?
3. 아메바의 수축포 관찰 실험

(1) 다음 그림과 같이 슬라이드 글라스 위에 커버 글라스 조각을 올려놓고 아메바 배양액을 한방을 떨어뜨린 다음 커버 글라스를 덮어서 프레파라트를 만들어라.

(2) 프레파라트를 현미경에 올려놓고 아메바를 가장 잘 볼 수 있도록 배율, 조명 상태 등을 조절한 다음 수축포를 찾았으면 손을 들어라.

4. 비커에 대장균이 들어있는 100ml의 액체가 담겨있다. 이 액체 1ml당 들어있는 대장균의 수를 알아보기 위하여 다음의 기구와 배지를 가지고 실험을 하려고 한다. 구체적인 실험 과정을 쓰고 각 과정에 대한 논리적인 근거를 쓰시오.
단, 액체 1ml당 1개에서 1010개까지 대장균이 들어있을 수 있다.
준비된 배지에서 모든 대장균이 살 수 있다.
직경 9cm의 페트리접시에서 보통 300~500개의 콜로니를 셀 수 있다.

기구와 배지
원심분리기, 배양기(37℃), 교반기, 피펫(1ml, 10m1), 저울, 여러 가지 크기의 비커, 액체배지와 고체배지

5. 녹색 식물의 광합성에 이산화탄소가 필요하다는 가설을 검증하기 위한 실험을 설계하시오.

가설 : 녹색 식물의 광합성에 이산화탄소가 필요하다

실험을 위한 가설로부터의 예측 :

실험 설계 :

 

제 12 회 전국 중․고등학생 수학․과학 경시대회
고등생물부문 본선 2차(실험) 문제 풀이

1.
(1) (5점) 대물마이크로 미터 눈금 6개에 접안마이크로밑의 눈금 24개가 겹치므로 접안마이크로미터 한 눈금의 길이는 (6×10)/24=2.5㎛이며, 포자의 가로, 세로는 각각 접안마이크로 미터 X개와 Y개에 걸쳐 있으므로, 가로는 X×2.5㎛, 세로는 Y×2.5㎛이다.
접안마이크로미터 한 눈금의 길이 계산-계산과정과 함께 2.5㎛ 쓴 경우 3점 눈금길이를 잘못 계산한 경우 감점 1점
포자의 크기 계산 2점

(2) (5점)
암술, 수술의 수, 꽃잎의 수, 꽃받침의 수, 꽃잎과 꽃받침의 모양에 각각 1점씩

(3) (5점)
a=6, b=7, c=4이므로 4×2/(6+7)=8/13
a, b, c는 맞았지만 수식을 잘못 사용한 경우, 2점
a, b, c의 수치는 정확하지 않지만 수식은 맞는 경우, 2점

(4) (5점) 3번 시험관

2.
낭배를 찾은 경우 (10점)
낭배라고 생각되는 이유 (10점)
낭배를 찾지 못하면 (0점)
페트리 접시 속에는 미수정란, 포배, 낭배, 신경배가 각각 1개씩 들어있다. 미 수정란은 분열을 하지 않아서 표면이 매끄럽다. 포배는 많은 수의 할구로 이루어져 있으나 원구가 형성되지 않은 상태이다. 낭배는 적도 아랫부분에 할구의 함입이 일어나 원구가 검은 띠 모양의 곡선으로 관찰된다. 신경배는 윗부분에 신경판 또는 신경관이 직선으로 형성되어 있다.
3. 채점기준
현미경 조작 (1점)
프레파라트 제작 (4점)
조명 (2점)
배율 (2점)
아메바관찰 (1점)
수축포 관찰 (10점)

4. 채점기준 각 5점씩
희석 방법
개체수를 모름
실험 설계
콜로니(colony) 개념

5.
실험을 위해 가설로부터 논리적인 예측이 진술되었는가? (3점)
실험 설계의 내용이 가설 검증에 타당한가? (4점)
변인 통제가 고려되고 있는가? (3점)
이산화탄소의 양 또는 유무를 측정하는 방법이 타당한가? (3점)
독립 변인의 조작 방법이 구체적인가? (4점)
종속 변인의 측정 방법이 구체적인가? (3점)

조상환

Leave a Reply

*

captcha *