제13회 중․고등학생 수학․과학 경시대회 고등학생부 생물1차(지필)문제지

13회 생물-고등예선 ←PDF로 보기

13회고등예선(해설) ←PDF로 보기

 

화면깨짐현상과 그림자료가 보이지 않을수 있으니 PDF로보기를 열으셔서 열람하시기 바랍니다.

 

제13회 중․고등학생 수학․과학 경시대회

고등학생부 생물1차(지필)문제지

 

1. 아래 그림은 식물세포와 동물세포의 모식도이다. 잘 관찰한 다음 물음에 답하여라.

 

 

(1) 식물과 동물의 차이점을 말하여라.

 

(2) 식물세포에 있으나 동물세포에는 없는 세포구조는 무엇인가?

 

(3) 유전인자인 DNA를 가지고 있는 세포구조는 무엇인가?

 

(4) 식물세포에서 ATP가 합성되는 장소는?

 

(5) 동물세포에서 ATP가 합성되는 장소는?

 

(6) 일반적으로 식물세포에서 NADH2와 NADPH2를 만드는 장소는?

 

(7) 일반적으로 동물세포에서 NADH2와 NADPH2를 만드는 장소는?

 

(8) 식물세포의 진화를 세포공생이론으로 설명하여라.

2. 다음 그림은 개구리의 일종인 제노퍼스의 32할구기의 모식도이다. 물음에 답하여라. 발생이 끝난 후 각 할구의 운명은 아래와 같다.

공 여 자 수 용 자 A와 B(식물반구 세포)→창자(내배엽성)

D(중간대)혈액

→(중배엽성)

I(동물반구세포)

→신경조직(외배엽성)

F(동물반구세포)

→표피 (외배엽성)

 

(1) 낭배 초기 C 할구는 무엇으로 되는가?

(2) 낭배운동이 끝난 후 C는 무엇으로 되는가?

(3) 32할구기와 포배기에 각 세포를 분리한 후 배양한 결과는 다음과 같다.

32할구기 A세포 → 1 표피 세포32할구기 B세포 → 1 표피 세포

32할구기 C세포 → 1 표피 세포

32할구기 D세포 → 1 표피 세포

32할구기 E세포 → 1 표피 세포

9할구기 F세포 → 1 표피 세포

32할구기 C, D, E, F를 함께 배양 → 1 표피세포

포배 기 A세포 → 창자 세포포배 기 B세포 → 창자 세포

포배 기 C세포 → 척 색

포배 기 D세포 → 혈 액

위의 실험 결과의 중요성을 설명하여라.

 

 

(4) 문제 (3)의 할구 분리 실험을 통하여 알 수 있는 중간대의 운명을 결정하는 부위는 어디인가?

 

(5) D할구를 A할구로 대치시키는 이식 실험 결과의 중요성을 설명하여라.

3. 근섬유(근육세포)를 며칠동안 0℃의 50% 글리세롤 용액에 넣어두면 세포막이 파괴되고, 근육세포의 수용성 물질은 모두 빠져 나오지만 수축 작용과 관련된 세포골격과 같은 비용해성 물질은 온전하게 남아 있다. 이와 같이 처리한 근육세포를 가지고 여러 가지 조건에서 수축에 따른 장력과 ATP의 가수분해를 측정하여 다음과 같은 결과를 얻다. 이에 근거하여 다음 물음에 답하여라.

 

 

 

(1) 실험 A의 결과를 보고 내릴 수 있는 결론은 무엇인가?

 

 

(2) 실험 B의 결과를 보고 내릴 수 있는 결론은 무엇인가?

 

 

(3) 실험 C의 결과를 보고 어떤 결론을 내릴 수 있는가?

 

 

(4) 실험 D의 결과를 보고 다음에 답하라.

① 칼슘은 있으나 ATP를 제거하였을 때 근육이 이완되지 못하는 현상을 무엇이라고 하는가?

 

 

② 근육세포가 수축하고 이완하는 조건을 설명하라.

 

 

(5) 근육세포에서 칼슘농도는 어떻게 조절되는지 설명하여라

4. 적혈구의 산소운반기능을 담당하는 헤모글로빈 분자는 α글로빈과 β글로빈이라는 두 구성성분으로 이루어져있다. 다음 염기서열은 β-글로빈의 전체 아미노산 서열에 대한 정보를 처음부터 끝까지 간직하고 있는 DNA이중나선 중한 가닥을 예시하고 있는 것이다. 다른 한 가닥은 이에 정확히 상보적인 서열이다. 현재 분자생물학 실험에서는 PCR(중합효소연쇄반웅)이라는 기술로 특정부위 유전자(DNA)를 만들어 낼 수 있다. β글로빈의 유전자 전부를 PCR하기 위해서 사용되는 2개의 primer (각 15개 염기)를 쓰시오. (단, 염기서열은 5’에서 3’으로 써야하고, β-글로빈을 구성하는 아미노산은 130개 이상이다)

 

5′-ACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGG

GGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGACAGGCTGCTGGTGGTC

TACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCT

GTTATTGCCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGT

TTTTGGCCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGGGTGAGC

TGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGC

TGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTG

CCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTTAA

CTCGCT-3′

 

제13회 중․고등학생 수학, 과학 경시대회고등학생부 생물 1차 (지필) 모범 답안
문항 소문항 답 안 점수 비고
1 식물은 독립영양생물이지만 동물은 종속영양생물이다. 5
‘독립영양’, ‘종속영양’ 용어 누락 3
2 세포벽, 액포, 엽록체 (글리옥시좀, 색소체) 5
3 핵, 엽록체, 미토콘드리아 5
4 엽록체, 미토콘드리아, 세포질 5
엽록체, 미토콘드리아 3
5 미토콘드리아. 세포질 5
미토콘드리아 3
6 NADH2 : 미토콘드리아, 세포질NADPH2 : 엽록체 5
NADH2 : 미토콘드리아, NADPH2 : 엽록체 3
7 NADH2 : 미토콘드리아, 세포질NADPH2 : 없음 5
NADH2 : 미토콘드리아 3
8 미토콘드리아나 엽록체 같은 세포기관은 각각 독립된 생물이었던 것이 한개의 세포안에서 공동생활(상리공생)을 하다가 세포기관으로 분화되어 오늘날의 식물세포로 발생했다. (혐기성 호흡만을 할 수 있었던 원시진핵생물이 삼킨 호기성 세균이 상리공생을 하면서 미토콘드리아의 기원이 되었고, 원시남세균의 상리공생으로 엽록체의 기원이 되어 오늘날의 식물세포로 발생했다.) 15
호기성 세균, 원시남세균의 용어 누락 10
만점 소계 50
2 1 원구배순부 또는 원구상순부 10
2 척색(삭) 5
척추 3
3 32할구기와 포배기 사이에 C와 D세포가 외배엽성인 표피세포로 될 운명이 각각 척색과 혈구 같은 중배엽성 세포로 운명이 결정(또는 유도)된다. 15
세포의 운명이 결정되는 시기를 누락 5
4 A와 B같은 식물반구세포 10
식물극 또는 A부위 5
5 등쪽 식물반구세포(A)가 바로 위에 위치한 중간대의 C세포를 등쪽 중배엽세포로 유도한다. 이들 유도된 세포들이 낭배초기에 원구배순부로 변하여 낭배운동을 일으키며 그 결과 2중배로 발생한다. 15
‘유도’, ‘2중배’ 누락 10
유도작용과 2중배 중 한가지에 대해서만 설명 5
만점 소계 55

 

 

문항 소문항 답 안 점수 비고
3 1 근수축에는 ATP와 칼슘이 필요하며, 칼슘이 없으면 이완한다. 10
ATP누락 5
2 근수축의 장력은 칼슘농도에 비례하여 증가하며 포화된다. 10
포화에 대한 설명 누락 5
3 ATP분해는 칼슘농도에 비례하여 증가하며 포화된다. 10
포화에 대한 설명 누락 5
4-① 사(후)경직 5
4-② ATP존재하에 칼슘이 있으면 수축하고, 칼슘이 없으면 이완한다. 5
5 운동신경의 흥분이 근육세포에 전달되면 세포막에 활동전위가 발생되며, 이에 따라서 근소포체에 저장되었던 칼슘이 방출되어 칼슘농도가 증가한다. 이 활동전위가 소멸되면 방출되었던 칼슘은 능동수송에 의해 근소포체 내로 운반되기 때문에 농도가 감소한다. 15
‘근소포체’ 누락 5
만점 소계 55
4 TTAAGTGATACTTGT 20
UUAAGUGAUACUUGU 10
ATGGTGCACCTGACT 20
AUGGUGCACCUGACU 10
만점 소계 40
만점 총계 200

 

조상환

Leave a Reply

*

captcha *